ID: 1187628269_1187628280

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1187628269 1187628280
Species Human (GRCh38) Human (GRCh38)
Location X:21141396-21141418 X:21141438-21141460
Sequence CCAGGTGGCTCGCTCAGGTGCCA TAGGTCCTAGAGCCTTTGGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 31, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!