ID: 1187645970_1187645971

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1187645970 1187645971
Species Human (GRCh38) Human (GRCh38)
Location X:21347923-21347945 X:21347937-21347959
Sequence CCTATTTAGAGTATGCTTAGCTT GCTTAGCTTCTTGAATCTGTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!