ID: 1187672866_1187672874

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1187672866 1187672874
Species Human (GRCh38) Human (GRCh38)
Location X:21685960-21685982 X:21685998-21686020
Sequence CCCTGAGGTGGCTGTCCCTAACC ACTTTAGAATGTAGGGTGCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 11, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!