ID: 1187698170_1187698185

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1187698170 1187698185
Species Human (GRCh38) Human (GRCh38)
Location X:21941130-21941152 X:21941164-21941186
Sequence CCCGCCGGCCGCGCCGCCCTTCC GTCCACCCGCGCTCCCACGCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 42, 4: 436} {0: 1, 1: 0, 2: 0, 3: 8, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!