ID: 1187698180_1187698191

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1187698180 1187698191
Species Human (GRCh38) Human (GRCh38)
Location X:21941151-21941173 X:21941190-21941212
Sequence CCGGGCCCTGGCCGTCCACCCGC GCCGCCTTCGCGCTCCCGCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 497} {0: 1, 1: 0, 2: 0, 3: 6, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!