ID: 1187698183_1187698200

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1187698183 1187698200
Species Human (GRCh38) Human (GRCh38)
Location X:21941162-21941184 X:21941209-21941231
Sequence CCGTCCACCCGCGCTCCCACGCG TCGGGGAGTCCCCGGGCTGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 196} {0: 1, 1: 0, 2: 1, 3: 16, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!