ID: 1187698192_1187698201

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1187698192 1187698201
Species Human (GRCh38) Human (GRCh38)
Location X:21941191-21941213 X:21941210-21941232
Sequence CCGCCTTCGCGCTCCCGCTCGGG CGGGGAGTCCCCGGGCTGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 126} {0: 1, 1: 0, 2: 2, 3: 24, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!