ID: 1187698198_1187698216

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1187698198 1187698216
Species Human (GRCh38) Human (GRCh38)
Location X:21941204-21941226 X:21941245-21941267
Sequence CCCGCTCGGGGAGTCCCCGGGCT CCCCATGGGACGAGGGTTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 111} {0: 1, 1: 0, 2: 0, 3: 4, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!