ID: 1187698205_1187698216

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1187698205 1187698216
Species Human (GRCh38) Human (GRCh38)
Location X:21941219-21941241 X:21941245-21941267
Sequence CCCGGGCTGCCGGGCGCGGGCGG CCCCATGGGACGAGGGTTGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 53, 4: 470} {0: 1, 1: 0, 2: 0, 3: 4, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!