ID: 1187724722_1187724732

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1187724722 1187724732
Species Human (GRCh38) Human (GRCh38)
Location X:22190559-22190581 X:22190608-22190630
Sequence CCATGACTATGATGGAGGGTAAG CAGGGTATGCTGGTGAAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 97} {0: 1, 1: 0, 2: 5, 3: 32, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!