ID: 1187844792_1187844802

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1187844792 1187844802
Species Human (GRCh38) Human (GRCh38)
Location X:23524338-23524360 X:23524367-23524389
Sequence CCATCCCCACAACAGCAATGGCA GGAGAGCATCTCTGGGCACTGGG
Strand - +
Off-target summary No data {0: 5, 1: 31, 2: 54, 3: 106, 4: 387}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!