ID: 1187854706_1187854707

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1187854706 1187854707
Species Human (GRCh38) Human (GRCh38)
Location X:23625584-23625606 X:23625601-23625623
Sequence CCAGGGGAAAACTGTTTCAATTT CAATTTCCCAGTAACACAGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 21, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!