ID: 1187924739_1187924741

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1187924739 1187924741
Species Human (GRCh38) Human (GRCh38)
Location X:24239309-24239331 X:24239324-24239346
Sequence CCGTGACAGGCTTCTGTGTTTAA GTGTTTAAGTAGAAGGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 514} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!