ID: 1188003888_1188003896

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1188003888 1188003896
Species Human (GRCh38) Human (GRCh38)
Location X:25004751-25004773 X:25004789-25004811
Sequence CCTCAGCGCGGCTATGCTAGAGG CCGCCGTGGCCGGGTCGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 36} {0: 1, 1: 0, 2: 1, 3: 13, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!