ID: 1188136443_1188136447

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1188136443 1188136447
Species Human (GRCh38) Human (GRCh38)
Location X:26499637-26499659 X:26499654-26499676
Sequence CCCCTGGCTATCGGTTAGTGTTC GTGTTCCCCTTCAAGCTTTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 37} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!