ID: 1188256493_1188256498

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1188256493 1188256498
Species Human (GRCh38) Human (GRCh38)
Location X:27967352-27967374 X:27967379-27967401
Sequence CCCACAAGCAGCTGCAAACTGCC ATGCTGTTTTACATTAAACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 166} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!