ID: 1188364300_1188364302

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1188364300 1188364302
Species Human (GRCh38) Human (GRCh38)
Location X:29295737-29295759 X:29295763-29295785
Sequence CCAAGATGAAACTCTGTCCATCA CTACGCTATTACAAGCTCGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!