ID: 1188444618_1188444622

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1188444618 1188444622
Species Human (GRCh38) Human (GRCh38)
Location X:30243139-30243161 X:30243163-30243185
Sequence CCAGGGCCACATCCAGTAGCTCT CCCAACCCATGTGAGATCTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 194} {0: 1, 1: 0, 2: 1, 3: 5, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!