ID: 1188461775_1188461776

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1188461775 1188461776
Species Human (GRCh38) Human (GRCh38)
Location X:30435441-30435463 X:30435457-30435479
Sequence CCGTAGGTAGCAGTTGCTACAGC CTACAGCTCCACCACTGAGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!