ID: 1188465304_1188465307

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1188465304 1188465307
Species Human (GRCh38) Human (GRCh38)
Location X:30472818-30472840 X:30472843-30472865
Sequence CCCACTTCCTATTCATAACACAG ACGTCTCCAAGAACAAGAAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!