ID: 1188715991_1188715995

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1188715991 1188715995
Species Human (GRCh38) Human (GRCh38)
Location X:33459601-33459623 X:33459614-33459636
Sequence CCTATCAGGTACTATACCTGGTA ATACCTGGTACCTGGGTGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 300} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!