ID: 1188806724_1188806728

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1188806724 1188806728
Species Human (GRCh38) Human (GRCh38)
Location X:34599983-34600005 X:34600011-34600033
Sequence CCTTGGTTAATTTTCTGCCTCAA TGTCTAATGCTGTCAGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 22, 3: 64, 4: 402} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!