ID: 1188816003_1188816004

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1188816003 1188816004
Species Human (GRCh38) Human (GRCh38)
Location X:34715062-34715084 X:34715091-34715113
Sequence CCATGGCTACAAGTATAACTTCT TAAGCTCCAGACATTGATATTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 12, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!