ID: 1188890811_1188890815

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1188890811 1188890815
Species Human (GRCh38) Human (GRCh38)
Location X:35609789-35609811 X:35609811-35609833
Sequence CCTGGATGCGTGAAACATTTAGT TGCTGAAGGCCCAGGTCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!