ID: 1188892303_1188892314

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1188892303 1188892314
Species Human (GRCh38) Human (GRCh38)
Location X:35625904-35625926 X:35625945-35625967
Sequence CCTGCCGGTGGGACGCGGGCTTG GCGGCTGGTGGGGAGCATGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 53, 4: 533}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!