ID: 1188895133_1188895136

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1188895133 1188895136
Species Human (GRCh38) Human (GRCh38)
Location X:35658624-35658646 X:35658640-35658662
Sequence CCATGGTTGACAAAGATTTTCAA TTTTCAACCCAGATGGACCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!