ID: 1188916634_1188916638

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1188916634 1188916638
Species Human (GRCh38) Human (GRCh38)
Location X:35919756-35919778 X:35919772-35919794
Sequence CCGGACGGATCCACATCTGTTTT CTGTTTTCTGGCTACCGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 464} {0: 1, 1: 0, 2: 1, 3: 11, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!