ID: 1188932284_1188932287

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1188932284 1188932287
Species Human (GRCh38) Human (GRCh38)
Location X:36126290-36126312 X:36126329-36126351
Sequence CCTATGTCAACGTGTTCTCACTG GTGTGAGAACATGCAGTGTTTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 97, 3: 2244, 4: 22398} {0: 25, 1: 4539, 2: 11585, 3: 18008, 4: 10905}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!