ID: 1188960566_1188960574

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1188960566 1188960574
Species Human (GRCh38) Human (GRCh38)
Location X:36486584-36486606 X:36486620-36486642
Sequence CCCTCCACCTTCCAGAGAAAACA TTATTGGTTAGATGCTATATGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 5, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!