ID: 1188998107_1188998115

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1188998107 1188998115
Species Human (GRCh38) Human (GRCh38)
Location X:36911016-36911038 X:36911066-36911088
Sequence CCCCTTTTGCCCAATAGAAGAGG TGTTAAGAAACAGAAATAATTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 87, 4: 894}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!