ID: 1189001935_1189001951

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1189001935 1189001951
Species Human (GRCh38) Human (GRCh38)
Location X:36957499-36957521 X:36957540-36957562
Sequence CCGGGCTCCCTCCGCGGGCCAGG TCCGCGCGAGCCTCGGGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 291} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!