ID: 1189015754_1189015760

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1189015754 1189015760
Species Human (GRCh38) Human (GRCh38)
Location X:37094865-37094887 X:37094914-37094936
Sequence CCTCCTAGCTAAATCTGTGTATA ACTCTTAGAAGTGGAATTTCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 12, 4: 134} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!