ID: 1189021835_1189021848

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1189021835 1189021848
Species Human (GRCh38) Human (GRCh38)
Location X:37349441-37349463 X:37349477-37349499
Sequence CCAGGCGAAGCGCCCCAGGAAGG GGGGTGACTTCGGTTCTGCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 116} {0: 1, 1: 0, 2: 0, 3: 4, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!