ID: 1189037308_1189037322

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1189037308 1189037322
Species Human (GRCh38) Human (GRCh38)
Location X:37506112-37506134 X:37506143-37506165
Sequence CCATTCAGCCCTGCCCCATCTGC CAGGATCTGCGGGGGTGGAGGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 5, 3: 50, 4: 521} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!