ID: 1189112775_1189112778

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1189112775 1189112778
Species Human (GRCh38) Human (GRCh38)
Location X:38310615-38310637 X:38310633-38310655
Sequence CCGTGAGAACCACAGTATGCTCT GCTCTCCACCACAGGCTACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 170} {0: 1, 1: 0, 2: 1, 3: 9, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!