ID: 1189130844_1189130855

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1189130844 1189130855
Species Human (GRCh38) Human (GRCh38)
Location X:38496544-38496566 X:38496595-38496617
Sequence CCAGCCTTGTGTCACCTCCACTC CTGTAGACAGAGCTGGGGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 50, 4: 426}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!