ID: 1189152090_1189152100

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1189152090 1189152100
Species Human (GRCh38) Human (GRCh38)
Location X:38719466-38719488 X:38719513-38719535
Sequence CCCTGCTGGATCTGGAGGGTTGG CGGCGAACAGCAGTGGTGGACGG
Strand - +
Off-target summary No data {0: 5, 1: 75, 2: 141, 3: 72, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!