ID: 1189153977_1189153981

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1189153977 1189153981
Species Human (GRCh38) Human (GRCh38)
Location X:38736596-38736618 X:38736643-38736665
Sequence CCTTTGCTGGAAAAAAAAAAAAC ACAAGGGTACTGAACCCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 55, 3: 776, 4: 6546} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!