ID: 1189248528_1189248535

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1189248528 1189248535
Species Human (GRCh38) Human (GRCh38)
Location X:39581908-39581930 X:39581952-39581974
Sequence CCCTCTGGCAGGAAGTTATTCCC TAGAGCTATAACCCACAACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 125} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!