ID: 1189259107_1189259117

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1189259107 1189259117
Species Human (GRCh38) Human (GRCh38)
Location X:39665113-39665135 X:39665152-39665174
Sequence CCTCTGCCTTTTTATTCCATCTG GATGGTGCCTGTCCATGTTGAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 53, 3: 175, 4: 636} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!