ID: 1189276114_1189276123

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1189276114 1189276123
Species Human (GRCh38) Human (GRCh38)
Location X:39787325-39787347 X:39787360-39787382
Sequence CCCTTGAGGGGGCCCTCCGATGC CTTCTTGGTGTCATCATATTTGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 6, 3: 16, 4: 47} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!