ID: 1189276114_1189276125

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1189276114 1189276125
Species Human (GRCh38) Human (GRCh38)
Location X:39787325-39787347 X:39787377-39787399
Sequence CCCTTGAGGGGGCCCTCCGATGC ATTTGGCAGGTTTTTCCAGACGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 6, 3: 16, 4: 47} {0: 8, 1: 13, 2: 10, 3: 61, 4: 442}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!