ID: 1189299404_1189299412

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1189299404 1189299412
Species Human (GRCh38) Human (GRCh38)
Location X:39941829-39941851 X:39941876-39941898
Sequence CCACCCAAAGCCTACAGGGGGCC TCCCACCCACAGCAGAGCTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 10, 3: 38, 4: 323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!