ID: 1189309783_1189309792

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1189309783 1189309792
Species Human (GRCh38) Human (GRCh38)
Location X:40011134-40011156 X:40011183-40011205
Sequence CCCGTGGGTTGCCCTAGGGGAAG CTGTGTCCTGTGCAGTTCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 112} {0: 1, 1: 1, 2: 2, 3: 35, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!