ID: 1189357534_1189357539

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1189357534 1189357539
Species Human (GRCh38) Human (GRCh38)
Location X:40322626-40322648 X:40322645-40322667
Sequence CCCTACCCAAATGAGATATGGGT GGGTTGCTTTGGAGTCTGTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 91} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!