ID: 1189362080_1189362082

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1189362080 1189362082
Species Human (GRCh38) Human (GRCh38)
Location X:40360501-40360523 X:40360515-40360537
Sequence CCTCTATCACAGTGTCCGTGGGA TCCGTGGGAAAGGAGATCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 103} {0: 1, 1: 0, 2: 0, 3: 15, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!