ID: 1189391556_1189391562

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1189391556 1189391562
Species Human (GRCh38) Human (GRCh38)
Location X:40580956-40580978 X:40581000-40581022
Sequence CCGGGAGCCTGGACGAGTCCGAG GGCTGTCGCCCGTGTCCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 103} {0: 1, 1: 0, 2: 0, 3: 10, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!