ID: 1189491391_1189491399

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1189491391 1189491399
Species Human (GRCh38) Human (GRCh38)
Location X:41473933-41473955 X:41473970-41473992
Sequence CCTGCGCGAACTCGCCGCCTTCG CGCGTGCCGGGCGCGCTGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 25} {0: 1, 1: 0, 2: 0, 3: 21, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!