ID: 1189534510_1189534526

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1189534510 1189534526
Species Human (GRCh38) Human (GRCh38)
Location X:41923171-41923193 X:41923205-41923227
Sequence CCGCCCCGGCGCGGGCGGCGGGG GAGCGAGGGCGGCCCGGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 444} {0: 1, 1: 1, 2: 8, 3: 52, 4: 497}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!