ID: 1189593138_1189593146

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1189593138 1189593146
Species Human (GRCh38) Human (GRCh38)
Location X:42536802-42536824 X:42536836-42536858
Sequence CCCTAGCAGTCTGCACGAAGTGG ACTCACACACTGTTGGTAGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 33, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!